Review



6w ula plates  (Corning Life Sciences)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Corning Life Sciences 6w ula plates
    6w Ula Plates, supplied by Corning Life Sciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/6w+plate/6w+ula+plates/pm39827811-68-8-11
    Average 90 stars, based on 1 article reviews
    6w ula plates - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Software:

    Article Title: Geometric effects position renal vesicles during kidney development.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-LIM1/LHX1 abcam Cat#ab229474; RRID:AB_2924798 Anti-LIM1/LHX1 DSHB DSHB Hybridoma Product 4F2; RRID:AB_531784 Anti-SIX2 proteintech Cat#11562-1-AP; RRID:AB_2189084 Chemicals, peptides, and recombinant proteins WNT9B R&D Cat#3669-WN Tamoxifen Thermo Scientific Chemicals Cat#J63509.03 DMEM-F12 Gibco Cat#21041025 trypLE Gibco Cat#12604013 FBS Gibco Cat#A5256801 EDTA Thermo Scientific Chemicals Cat#17892 DMEM Gibco Cat#41965039 DMSO Thermo Scientific Chemicals Cat#J66650.AK SYBR Green SuperMix Bio-Rad Cat#1725120 CHIR99021 Stemcell technologies Cat#72052 BSA Sigma-Aldrich Cat#A7906-10G Critical commercial assays Absolutely Rna Nanoperp kit Agilent technologies Cat#400753-12 PrimeScript RT Reagent Kit Takara Cat#RR037B Deposited data Source code This Paper https://git.bsse.ethz.ch/iber/Publications/ 2022_mederacke_conrad_renal_vesicles COMSOL model files This Paper https://git.bsse.ethz.ch/iber/Publications/ 2022_mederacke_conrad_renal_vesicles Experimental models: Organisms/strains Mouse: RjOrl:SWISS N/A RjOrl:SWISS Mouse: Tg(Hoxb7-Venus*)17Cos Chi et al.57 RRID:IMSR_JAX:016252 Mouse: B6; 129-Six2tm3(EGFP/cre/ERT2)Amc/J Kobayash et al.58 RRID:IMSR_JAX:009600 Mouse: B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J Madisen et al.59 RRID:IMSR_JAX:007914 Oligonucleotides mouse gapdh forward: AACTTTGGCATTGTGGAAGG This paper N/A mouse gapdh reverse: ATCCACAGTCTTCTGGGTGG This paper N/A mouse pax 8 forward: CACAAAGGCCCCTCCTAGTT This paper N/A mouse pax 8 reverse: GCGAGTGTCCCTCAGTCTGT This paper N/A mouse wnt 4 forward: CTCAAAGGCCTGATCCAGAG This paper N/A mouse wnt 4 reverse: TCACAGCCACACTTCTCCAG This paper N/A mouse cited 1 forward: CATCCTTCAACCTGCATCCT This paper N/A mouse cited 1 reverse: ACCAGCAGGAGGAGAGACAG This paper N/A mouse lef1 forward: TCATCACCTACAGCGACGAG This paper N/A mouse lef1 reverse: GAAGGTGGGGATTTCAGGAG This paper N/A (Continued on next page) Cell Reports 42, 113526, December 26, 2023 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms ImageJ https://imagej.nih.gov/ij/index.html COMSOL 6.0 COMSOL Multiphysics http://comsol.com Python 3.9 Python https://www.python.org MATLAB 2022b Mathworks https://www.mathworks.com R 4.2.1 R Project https://www.r-project.org Blender 3.0 Blender https://www.blender.org Imaris 10.0 Bitplane, Oxford Instruments https://imaris.oxinst.com QuantStudio 3 Thermo Fisher Scientific Other Affi-Gel Blue beads Biorad Cat#153-730 96w Plate Corning Cat#3598 6w Plate Corning Cat3516 24 mm Transwell with 0.4 mm Pore Polyester Membrane Insert Corning Cat#3450 ..

    Membrane:

    Article Title: Geometric effects position renal vesicles during kidney development.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-LIM1/LHX1 abcam Cat#ab229474; RRID:AB_2924798 Anti-LIM1/LHX1 DSHB DSHB Hybridoma Product 4F2; RRID:AB_531784 Anti-SIX2 proteintech Cat#11562-1-AP; RRID:AB_2189084 Chemicals, peptides, and recombinant proteins WNT9B R&D Cat#3669-WN Tamoxifen Thermo Scientific Chemicals Cat#J63509.03 DMEM-F12 Gibco Cat#21041025 trypLE Gibco Cat#12604013 FBS Gibco Cat#A5256801 EDTA Thermo Scientific Chemicals Cat#17892 DMEM Gibco Cat#41965039 DMSO Thermo Scientific Chemicals Cat#J66650.AK SYBR Green SuperMix Bio-Rad Cat#1725120 CHIR99021 Stemcell technologies Cat#72052 BSA Sigma-Aldrich Cat#A7906-10G Critical commercial assays Absolutely Rna Nanoperp kit Agilent technologies Cat#400753-12 PrimeScript RT Reagent Kit Takara Cat#RR037B Deposited data Source code This Paper https://git.bsse.ethz.ch/iber/Publications/ 2022_mederacke_conrad_renal_vesicles COMSOL model files This Paper https://git.bsse.ethz.ch/iber/Publications/ 2022_mederacke_conrad_renal_vesicles Experimental models: Organisms/strains Mouse: RjOrl:SWISS N/A RjOrl:SWISS Mouse: Tg(Hoxb7-Venus*)17Cos Chi et al.57 RRID:IMSR_JAX:016252 Mouse: B6; 129-Six2tm3(EGFP/cre/ERT2)Amc/J Kobayash et al.58 RRID:IMSR_JAX:009600 Mouse: B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J Madisen et al.59 RRID:IMSR_JAX:007914 Oligonucleotides mouse gapdh forward: AACTTTGGCATTGTGGAAGG This paper N/A mouse gapdh reverse: ATCCACAGTCTTCTGGGTGG This paper N/A mouse pax 8 forward: CACAAAGGCCCCTCCTAGTT This paper N/A mouse pax 8 reverse: GCGAGTGTCCCTCAGTCTGT This paper N/A mouse wnt 4 forward: CTCAAAGGCCTGATCCAGAG This paper N/A mouse wnt 4 reverse: TCACAGCCACACTTCTCCAG This paper N/A mouse cited 1 forward: CATCCTTCAACCTGCATCCT This paper N/A mouse cited 1 reverse: ACCAGCAGGAGGAGAGACAG This paper N/A mouse lef1 forward: TCATCACCTACAGCGACGAG This paper N/A mouse lef1 reverse: GAAGGTGGGGATTTCAGGAG This paper N/A (Continued on next page) Cell Reports 42, 113526, December 26, 2023 13 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms ImageJ https://imagej.nih.gov/ij/index.html COMSOL 6.0 COMSOL Multiphysics http://comsol.com Python 3.9 Python https://www.python.org MATLAB 2022b Mathworks https://www.mathworks.com R 4.2.1 R Project https://www.r-project.org Blender 3.0 Blender https://www.blender.org Imaris 10.0 Bitplane, Oxford Instruments https://imaris.oxinst.com QuantStudio 3 Thermo Fisher Scientific Other Affi-Gel Blue beads Biorad Cat#153-730 96w Plate Corning Cat#3598 6w Plate Corning Cat3516 24 mm Transwell with 0.4 mm Pore Polyester Membrane Insert Corning Cat#3450 ..



    Similar Products

    6w ula plates  (Corning Life Sciences)
    90
    Corning Life Sciences 6w ula plates
    6w Ula Plates, supplied by Corning Life Sciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/6w+plate/6w+ula+plates/pm39827811-68-8-11
    Average 90 stars, based on 1 article reviews
    6w ula plates - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    cytoview mea plates m384-tmea-6w  (Axion BioSystems)
    90
    Axion BioSystems cytoview mea plates m384-tmea-6w
    Cytoview Mea Plates M384 Tmea 6w, supplied by Axion BioSystems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/6w+plate/24+well+mea+plate/pm39520988-492-6-39
    Average 90 stars, based on 1 article reviews
    cytoview mea plates m384-tmea-6w - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    6-well 64-electrode mea plate m384-tmea-6w  (Axion BioSystems)
    90
    Axion BioSystems 6-well 64-electrode mea plate m384-tmea-6w
    6 Well 64 Electrode Mea Plate M384 Tmea 6w, supplied by Axion BioSystems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/6w+plate/cytoview+48+well+mea+plates/pmc11706071-30-8-5
    Average 90 stars, based on 1 article reviews
    6-well 64-electrode mea plate m384-tmea-6w - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    6-well mea plates m384-tmea-6w  (Axion BioSystems)
    90
    Axion BioSystems 6-well mea plates m384-tmea-6w
    A Representative images of sections from the day-60 <t>cerebral</t> <t>organoids</t> stained with SYN1 and MAP2. Scale bar, 20 μm. B Quantification of SYN1 + puncta density in both the isogenic control (Correct) and the patient-derived (Patient) organoids on day 60. N = 12. C Representative bright-field image of a day-45 organoid plated on a 64-electrode array in an <t>MEA</t> well. D Plate maps of mean firing rates of both Correct and Patient organoids on day 45 and day 60. E Representative wave forms of spiking behavior from a single electrode for each Correct or Patient organoid on day 60. F Representative raster plots of Correct and Patient organoids (day 60) over 5-min continuous recording. Quantification of mean firing rate ( G ), number of spikes ( H ), burst percentage ( I ) and burst frequency ( J ) based on data obtained from Correct and Patient organoids on day 45 and day 60 over 10 min recording. A bundle of more than 10 spikes within 100 ms was defined as a burst. N = 8 MEA wells per genotype. Data are presented as the mean ± SEM. The statistical significance was determined using two-tailed unpaired t-test. * P < 0.05; ** P < 0.01; *** P < 0.001. ns: no significance.
    6 Well Mea Plates M384 Tmea 6w, supplied by Axion BioSystems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/6w+plate/cytoview+48+well+mea+plates/pmc10853546-348-5-7
    Average 90 stars, based on 1 article reviews
    6-well mea plates m384-tmea-6w - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    6w plate  (Corning Life Sciences)
    90
    Corning Life Sciences 6w plate
    A Representative images of sections from the day-60 <t>cerebral</t> <t>organoids</t> stained with SYN1 and MAP2. Scale bar, 20 μm. B Quantification of SYN1 + puncta density in both the isogenic control (Correct) and the patient-derived (Patient) organoids on day 60. N = 12. C Representative bright-field image of a day-45 organoid plated on a 64-electrode array in an <t>MEA</t> well. D Plate maps of mean firing rates of both Correct and Patient organoids on day 45 and day 60. E Representative wave forms of spiking behavior from a single electrode for each Correct or Patient organoid on day 60. F Representative raster plots of Correct and Patient organoids (day 60) over 5-min continuous recording. Quantification of mean firing rate ( G ), number of spikes ( H ), burst percentage ( I ) and burst frequency ( J ) based on data obtained from Correct and Patient organoids on day 45 and day 60 over 10 min recording. A bundle of more than 10 spikes within 100 ms was defined as a burst. N = 8 MEA wells per genotype. Data are presented as the mean ± SEM. The statistical significance was determined using two-tailed unpaired t-test. * P < 0.05; ** P < 0.01; *** P < 0.001. ns: no significance.
    6w Plate, supplied by Corning Life Sciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/6w+plate/6w+plate/pm38060445-521-53-55
    Average 90 stars, based on 1 article reviews
    6w plate - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    6-well mea plates axion biosystems m384-tmea-6w  (Axion BioSystems)
    90
    Axion BioSystems 6-well mea plates axion biosystems m384-tmea-6w
    A Representative images of sections from the day-60 <t>cerebral</t> <t>organoids</t> stained with SYN1 and MAP2. Scale bar, 20 μm. B Quantification of SYN1 + puncta density in both the isogenic control (Correct) and the patient-derived (Patient) organoids on day 60. N = 12. C Representative bright-field image of a day-45 organoid plated on a 64-electrode array in an <t>MEA</t> well. D Plate maps of mean firing rates of both Correct and Patient organoids on day 45 and day 60. E Representative wave forms of spiking behavior from a single electrode for each Correct or Patient organoid on day 60. F Representative raster plots of Correct and Patient organoids (day 60) over 5-min continuous recording. Quantification of mean firing rate ( G ), number of spikes ( H ), burst percentage ( I ) and burst frequency ( J ) based on data obtained from Correct and Patient organoids on day 45 and day 60 over 10 min recording. A bundle of more than 10 spikes within 100 ms was defined as a burst. N = 8 MEA wells per genotype. Data are presented as the mean ± SEM. The statistical significance was determined using two-tailed unpaired t-test. * P < 0.05; ** P < 0.01; *** P < 0.001. ns: no significance.
    6 Well Mea Plates Axion Biosystems M384 Tmea 6w, supplied by Axion BioSystems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/6w+plate/cytoview+48+well+mea+plates/pm38128479-400-3-7
    Average 90 stars, based on 1 article reviews
    6-well mea plates axion biosystems m384-tmea-6w - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    standard 6w plate  (Sarstedt)
    90
    Sarstedt standard 6w plate
    A Representative images of sections from the day-60 <t>cerebral</t> <t>organoids</t> stained with SYN1 and MAP2. Scale bar, 20 μm. B Quantification of SYN1 + puncta density in both the isogenic control (Correct) and the patient-derived (Patient) organoids on day 60. N = 12. C Representative bright-field image of a day-45 organoid plated on a 64-electrode array in an <t>MEA</t> well. D Plate maps of mean firing rates of both Correct and Patient organoids on day 45 and day 60. E Representative wave forms of spiking behavior from a single electrode for each Correct or Patient organoid on day 60. F Representative raster plots of Correct and Patient organoids (day 60) over 5-min continuous recording. Quantification of mean firing rate ( G ), number of spikes ( H ), burst percentage ( I ) and burst frequency ( J ) based on data obtained from Correct and Patient organoids on day 45 and day 60 over 10 min recording. A bundle of more than 10 spikes within 100 ms was defined as a burst. N = 8 MEA wells per genotype. Data are presented as the mean ± SEM. The statistical significance was determined using two-tailed unpaired t-test. * P < 0.05; ** P < 0.01; *** P < 0.001. ns: no significance.
    Standard 6w Plate, supplied by Sarstedt, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/6w+plate/standard+6w+plate/pm37932372-388-26-29
    Average 90 stars, based on 1 article reviews
    standard 6w plate - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    6w suspension culture plate  (Sarstedt)
    90
    Sarstedt 6w suspension culture plate
    A Representative images of sections from the day-60 <t>cerebral</t> <t>organoids</t> stained with SYN1 and MAP2. Scale bar, 20 μm. B Quantification of SYN1 + puncta density in both the isogenic control (Correct) and the patient-derived (Patient) organoids on day 60. N = 12. C Representative bright-field image of a day-45 organoid plated on a 64-electrode array in an <t>MEA</t> well. D Plate maps of mean firing rates of both Correct and Patient organoids on day 45 and day 60. E Representative wave forms of spiking behavior from a single electrode for each Correct or Patient organoid on day 60. F Representative raster plots of Correct and Patient organoids (day 60) over 5-min continuous recording. Quantification of mean firing rate ( G ), number of spikes ( H ), burst percentage ( I ) and burst frequency ( J ) based on data obtained from Correct and Patient organoids on day 45 and day 60 over 10 min recording. A bundle of more than 10 spikes within 100 ms was defined as a burst. N = 8 MEA wells per genotype. Data are presented as the mean ± SEM. The statistical significance was determined using two-tailed unpaired t-test. * P < 0.05; ** P < 0.01; *** P < 0.001. ns: no significance.
    6w Suspension Culture Plate, supplied by Sarstedt, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/6w+plate/6w+suspension+culture+plate/pm37932372-405-59-63
    Average 90 stars, based on 1 article reviews
    6w suspension culture plate - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    A Representative images of sections from the day-60 cerebral organoids stained with SYN1 and MAP2. Scale bar, 20 μm. B Quantification of SYN1 + puncta density in both the isogenic control (Correct) and the patient-derived (Patient) organoids on day 60. N = 12. C Representative bright-field image of a day-45 organoid plated on a 64-electrode array in an MEA well. D Plate maps of mean firing rates of both Correct and Patient organoids on day 45 and day 60. E Representative wave forms of spiking behavior from a single electrode for each Correct or Patient organoid on day 60. F Representative raster plots of Correct and Patient organoids (day 60) over 5-min continuous recording. Quantification of mean firing rate ( G ), number of spikes ( H ), burst percentage ( I ) and burst frequency ( J ) based on data obtained from Correct and Patient organoids on day 45 and day 60 over 10 min recording. A bundle of more than 10 spikes within 100 ms was defined as a burst. N = 8 MEA wells per genotype. Data are presented as the mean ± SEM. The statistical significance was determined using two-tailed unpaired t-test. * P < 0.05; ** P < 0.01; *** P < 0.001. ns: no significance.

    Journal: Cell Death & Disease

    Article Title: CUL4B mutations impair human cortical neurogenesis through PP2A-dependent inhibition of AKT and ERK

    doi: 10.1038/s41419-024-06501-3

    Figure Lengend Snippet: A Representative images of sections from the day-60 cerebral organoids stained with SYN1 and MAP2. Scale bar, 20 μm. B Quantification of SYN1 + puncta density in both the isogenic control (Correct) and the patient-derived (Patient) organoids on day 60. N = 12. C Representative bright-field image of a day-45 organoid plated on a 64-electrode array in an MEA well. D Plate maps of mean firing rates of both Correct and Patient organoids on day 45 and day 60. E Representative wave forms of spiking behavior from a single electrode for each Correct or Patient organoid on day 60. F Representative raster plots of Correct and Patient organoids (day 60) over 5-min continuous recording. Quantification of mean firing rate ( G ), number of spikes ( H ), burst percentage ( I ) and burst frequency ( J ) based on data obtained from Correct and Patient organoids on day 45 and day 60 over 10 min recording. A bundle of more than 10 spikes within 100 ms was defined as a burst. N = 8 MEA wells per genotype. Data are presented as the mean ± SEM. The statistical significance was determined using two-tailed unpaired t-test. * P < 0.05; ** P < 0.01; *** P < 0.001. ns: no significance.

    Article Snippet: Organoids were placed into 6-well MEA plates (Axion Biosystems, Atlanta, GA, USA, Cat# M384-tMEA-6W) coated with poly-l-ornithine/laminin (Sigma) and with 64 platinum microelectrodes arrays per well.

    Techniques: Staining, Control, Derivative Assay, Two Tailed Test